 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circRNA.20159 | |||
| Gene | n/a | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Gestational Diabetes Mellitus | ICD-10 | Diabetes mellitus arising in pregnancy (O24.4) |
| DBLink | Link to database | PMID | 29526755 |
| Experimental Method | |||
| Sample Type | Placental Villi | Comparison | 30 Gestational Diabetes Mellitus (GDM) cases and 30 normal controls |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCTGGCTACAGCAAACATCA ReverseTGTCCTCCATGCTGTCAGAG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Yan, L, Feng, J, Cheng, F, Cui, X, Gao, L, Chen, Y, Wang, F, Zhong, T, Li, Y, Liu, L (2018). Circular RNA expression profiles in placental villi from women with gestational diabetes mellitus. Biochem. Biophys. Res. Commun., 498, 4:743-750. | |||